pe arginase 1 arg1 antibody  (R&D Systems)

Journal: Materials Today Bio

Article Title: Exosomal lncRNA OTUD6B-AS1 as a pathogenic nanocarrier promotes inflammatory macrophage polarization in endometritis via a targetable ceRNA circuit

doi: 10.1016/j.mtbio.2026.103027

Figure Lengend Snippet: Analysis of macrophage activation in the uterine tissue of cows with endometritis. (A, B) Representative immunofluorescence (IF) staining images (A) and quantitative analysis (B) of iNOS (M1 marker, red) in endometrial tissues from healthy cows and cows with endometritis. Nuclei were counterstained with DAPI (blue). (C, D) Representative IF staining images (C) and quantitative analysis (D) of Arg1 (M2 marker, red) in endometrial tissues. (E, F) Relative mRNA expression levels of iNOS (E) and Arg1 (F) in endometrial tissues, as determined by qPCR. (G, H) Relative expression levels of IL-1β, IL-6 and TNF-α in endometrial tissues, as determined by IHC. (I, J) Relative mRNA expression levels of IL-1β (I) and IL-6 (J) in endometrial tissues, as determined by qPCR. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: The antibodies used include iNOS (Proteintech, Cat # 18985-1-AP), Arg1 (Proteintech, Cat # 18985-1-AP), Goat Anti-Rabbit IgG (Bioss, Cat # bs-0295G) and Goat Anti-Mouse IgG (Bioss, Cat # bs-0296Gs).

Techniques: Activation Assay, Immunofluorescence, Staining, Marker, Expressing

Journal: Materials Today Bio

Article Title: Exosomal lncRNA OTUD6B-AS1 as a pathogenic nanocarrier promotes inflammatory macrophage polarization in endometritis via a targetable ceRNA circuit

doi: 10.1016/j.mtbio.2026.103027

Figure Lengend Snippet: Exosomes from LPS-stimulated EECs induce pro-inflammatory macrophage activation. (A) Schematic diagram of the experimental setup for exosome uptake. (B) Fluorescence microscopy images showing the uptake of PKH67-labeled exosomes (green) by macrophages. Cytoskeleton was stained with Phalloidin (red), and nuclei were stained with DAPI (blue). (C) Western blotting analysis of phosphorylated NF-κB p65 (p-p65) in macrophages treated with Control-exo or LPS-exo. (D, E) Representative immunofluorescence (IF) staining images (D) and quantitative analysis (E) of iNOS (greed) in macrophages. (F, G) Representative IF staining images (F) and quantitative analysis (G) of Arg1 (red) in macrophages. (H) Schematic diagram of co-culture experiments. (I, J) Relative mRNA expression levels of iNOS (I) and Arg1 (J) in macrophages after co-culture with EECs. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: The antibodies used include iNOS (Proteintech, Cat # 18985-1-AP), Arg1 (Proteintech, Cat # 18985-1-AP), Goat Anti-Rabbit IgG (Bioss, Cat # bs-0295G) and Goat Anti-Mouse IgG (Bioss, Cat # bs-0296Gs).

Techniques: Activation Assay, Fluorescence, Microscopy, Labeling, Staining, Western Blot, Control, Immunofluorescence, Co-Culture Assay, Expressing

Journal: Materials Today Bio

Article Title: Exosomal lncRNA OTUD6B-AS1 as a pathogenic nanocarrier promotes inflammatory macrophage polarization in endometritis via a targetable ceRNA circuit

doi: 10.1016/j.mtbio.2026.103027

Figure Lengend Snippet: Transcriptomic profiling reveals significant enrichment of lncRNA OTUD6B-AS1 in exosomes derived from LPS-stimulated EECs. (A, B) LPS-exo was treated with RNase A alone or in combination with Triton X-100 for 4 h, and then co-incubated with macrophages. Relative expression levels of iNOS (A) and Arg1 (B) in macrophages. (C) Schematic overview of the RNA sequencing and analysis workflow. (D) Volcano plot showing differentially expressed lncRNAs in LPS-exo compared to Control-exo. (E, F) Gene Ontology (GO) biological process enrichment analysis (E) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (F) of the differentially expressed lncRNAs. (G) qPCR validation of the 6 upregulated lncRNAs in Control-exo and LPS-exo. (H) LPS-exo was treated with RNase A alone or in combination with Triton X-100 for 4 h, and then co-incubated with macrophages. Relative mRNA expression level of lncRNA OTUD6B-AS1 in macrophages. (I) A proposed competing endogenous RNA (ceRNA) network involving lncRNA OTUD6B-AS1, miR-128, and Notch2. (J) Relative mRNA expression level of lncRNA OTUD6B-AS1 in control and LPS-stimulated EECs. (K, L) RNA fluorescence in situ hybridization (RNA-FISH) showing the subcellular localization of lncRNA OTUD6B-AS1 (red) in EECs (K) and its quantitative cytoplasmic/nuclear distribution (L). Nuclei were stained with DAPI (blue). (M – P) Relative mRNA expression levels of lncRNA OTUD6B-AS1 (M − O) and miR-128 (P) in endometrial tissues from healthy cows and cows with endometritis, as determined by qPCR (O, P) and RNA-FISH (M) with quantification (N). (Q) Western blotting analysis of Notch2, RBP-Jκ, and p-p65 protein levels in endometrial tissues. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: The antibodies used include iNOS (Proteintech, Cat # 18985-1-AP), Arg1 (Proteintech, Cat # 18985-1-AP), Goat Anti-Rabbit IgG (Bioss, Cat # bs-0295G) and Goat Anti-Mouse IgG (Bioss, Cat # bs-0296Gs).

Techniques: Derivative Assay, Incubation, Expressing, RNA Sequencing, Control, Biomarker Discovery, Fluorescence, In Situ Hybridization, Staining, Western Blot

Journal: Materials Today Bio

Article Title: Exosomal lncRNA OTUD6B-AS1 as a pathogenic nanocarrier promotes inflammatory macrophage polarization in endometritis via a targetable ceRNA circuit

doi: 10.1016/j.mtbio.2026.103027

Figure Lengend Snippet: EECs-derived exosomes induce pro-inflammatory macrophage activation via delivery of lncRNA OTUD6B-AS1. (A) Relative mRNA expression level of lncRNA OTUD6B-AS1 in macrophages treated with Control-exo or LPS-exo. (B, C) RNA-FISH images (B) and quantitative analysis (C) showing lncRNA OTUD6B-AS1 (red) transfer to macrophages after co-culture with Control-exo or LPS-exo. Nuclei were stained with DAPI (blue). (D) Relative mRNA expression level of lncRNA OTUD6B-AS1 in macrophages after transfection with lncRNA OTUD6B-AS1 overexpression plasmids (OE-lncRNA) or control plasmids (OE-NC). ( E – I) Western blotting analysis of Notch2, RBP-Jκ, and p-p65 (E), along with immunofluorescence (IF) quantitative analysis of iNOS (F, G) and Arg1 (H, I) protein levels in macrophages after transfection with OE-lncRNA or OE-NC. (J – N) Western blotting analysis of Notch2, RBP-Jκ, and p-p65 (J), along with IF quantitative analysis of iNOS (K, L) and Arg1 (M, N) protein levels in macrophages after lncRNA OTUD6B-AS1 knockdown (si-lncRNA) or control treatment (si-NC). (O) Relative mRNA expression level of lncRNA OTUD6B-AS1 in exosomes isolated from lncRNA OTUD6B-AS1-knockdown LPS-stimulated EECs (si-lncRNA-LPS-exo) or exosomes from siRNA NC-transfected LPS-stimulated EECs (si-NC-LPS-exo). (P – S) IF quantitative analysis of iNOS (P, Q) and Arg1 (R, S) protein levels in macrophages treated with si-lncRNA-LPS-exo or si-NC-LPS-exo. (T) Relative mRNA expression levels of iNOS and Arg1 in macrophages treated with exosomes isolated from control EECs overexpressing lncRNA OTUD6B-AS1 (OE-lncRNA-Control-exo) or exosomes from control plasmids-transfected EECs (OE-NC-Control-exo). ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001. (For interpretation of the references to colour in this figure legend, the reader is referred to the Web version of this article.)

Article Snippet: The antibodies used include iNOS (Proteintech, Cat # 18985-1-AP), Arg1 (Proteintech, Cat # 18985-1-AP), Goat Anti-Rabbit IgG (Bioss, Cat # bs-0295G) and Goat Anti-Mouse IgG (Bioss, Cat # bs-0296Gs).

Techniques: Derivative Assay, Activation Assay, Expressing, Control, Co-Culture Assay, Staining, Transfection, Over Expression, Western Blot, Immunofluorescence, Knockdown, Isolation

Journal: Materials Today Bio

Article Title: Exosomal lncRNA OTUD6B-AS1 as a pathogenic nanocarrier promotes inflammatory macrophage polarization in endometritis via a targetable ceRNA circuit

doi: 10.1016/j.mtbio.2026.103027

Figure Lengend Snippet: lncRNA OTUD6B-AS1 acts as a ceRNA by sponging miR-128 to facilitate pro-inflammatory macrophage activation. (A) Relative mRNA expression level of miR-128 in macrophages treated with Control-exo or LPS-exo. (B) Luciferase reporter assay in HEK293T cells co-transfected with wild-type (WT) or mutant (MUT) lncRNA OTUD6B-AS1 reporter plasmids and miR-128 mimic or mimic NC. (C) RNA pull-down detection of the enrichment of miR-128 to lncRNA OTUD6B-AS1. (D) Ago2 RIP assay analysis of the enrichment of lncRNA OTUD6B-AS1 pulled-down from the Ago2 protein. (E) Relative mRNA expression level of miR-128 in macrophages transfected with OE-NC or OE-lncRNA. (F – J) Western blotting analysis of Notch2, RBP-Jκ, and p-p65 (F), along with immunofluorescence (IF) quantitative analysis of iNOS (G, H) and Arg1 (I, J) protein levels in macrophages co-transfected with OE-lncRNA and miR-128 mimic or mimic NC. (K, L) Relative mRNA expression levels of IL-1β (K) and IL-6 (L) in macrophages co-transfected with OE-lncRNA and miR-128 mimic or mimic NC. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

Article Snippet: The antibodies used include iNOS (Proteintech, Cat # 18985-1-AP), Arg1 (Proteintech, Cat # 18985-1-AP), Goat Anti-Rabbit IgG (Bioss, Cat # bs-0295G) and Goat Anti-Mouse IgG (Bioss, Cat # bs-0296Gs).

Techniques: Activation Assay, Expressing, Control, Luciferase, Reporter Assay, Transfection, Mutagenesis, Western Blot, Immunofluorescence

Journal: Materials Today Bio

Article Title: Exosomal lncRNA OTUD6B-AS1 as a pathogenic nanocarrier promotes inflammatory macrophage polarization in endometritis via a targetable ceRNA circuit

doi: 10.1016/j.mtbio.2026.103027

Figure Lengend Snippet: Notch2 mediates the regulatory effect of the lncRNA OTUD6B-AS1/miR-128 axis on macrophage activation. (A) Predictive analysis of miR-128 targets using multiple databases. (B) Western blotting analysis of Notch2 protein levels in macrophages treated with Control-exo or LPS-exo. (C) Western blotting analysis of Notch2 protein levels in macrophages transfected with OE-NC or OE-lncRNA. (D – H) Western blotting analysis of Notch2, RBP-Jκ, and p-p65 (D), along with immunofluorescence (IF) quantitative analysis of iNOS (E, F) and Arg1 (G, H) protein levels in macrophages treated with OE-NC or OE-lncRNA and the Notch2 inhibitor DAPT. (I) Luciferase reporter assay in HEK293T cells co-transfected with WT or MUT Notch2 3′UTR reporter plasmids and miR-128 mimic or mimic NC. (J, K) Relative protein (J) and mRNA (K) expression levels of Notch2 in macrophages transfected with miR-128 mimic or mimic NC. (L – P) Western blotting analysis of Notch2, RBP-Jκ, and p-p65 (L), along with IF quantitative analysis of iNOS (M, N) and Arg1 (O, P) protein levels in macrophages co-treated with miR-128 inhibitor or inhibitor NC and DAPT. ∗p < 0.05, ∗∗p < 0.01, ∗∗∗p < 0.001, ∗∗∗∗p < 0.0001.

Article Snippet: The antibodies used include iNOS (Proteintech, Cat # 18985-1-AP), Arg1 (Proteintech, Cat # 18985-1-AP), Goat Anti-Rabbit IgG (Bioss, Cat # bs-0295G) and Goat Anti-Mouse IgG (Bioss, Cat # bs-0296Gs).

Techniques: Activation Assay, Western Blot, Control, Transfection, Immunofluorescence, Luciferase, Reporter Assay, Expressing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: The VIM-PRPF31-ARG1 three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 R: GGAGGTCTTGGTGATGTCCT , This paper , Sangon Biotech.

Techniques: Diagnostic Assay, Biomarker Discovery, Quantitative Proteomics

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Key candidate biomarkers modulate immune cell infiltration during post-stroke recovery (A) Comparison of immune cell infiltration abundances between DAC subtypes. (B) Correlation network depicting significant interactions among immune cells by ssGSEA. (C) Correlation heatmap depicting associations of VIM , ARG1 , and PRPF31 with infiltrating immune infiltration cells. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 R: GGAGGTCTTGGTGATGTCCT , This paper , Sangon Biotech.

Techniques: Comparison

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Mendelian randomization identifies ARG1 as a causal protective factor for IS (A) Forest plot of MR model results. (B) Scatterplot of the five MR models. Each point represents an IV, with the line on each point indicating the 95% CI. The y axis shows the effect of SNPs on the outcome, and the x axis shows the effect of SNPs on exposure. (C) Forest plot of MR analysis results for each ARG1 -associated SNP; the red line represents the pooled effect of all SNPs, indicating that increased ARG1 expression is associated with reduced ischemic stroke risk. (D) MR sensitivity analysis for ARG1 after removing SNPs using the leave-one-out method. The red line represents the pooled results for all SNPs. (E) Funnel plot of 11 SNPs on MR analysis.

Article Snippet: Primer Arg1 R: GGAGGTCTTGGTGATGTCCT , This paper , Sangon Biotech.

Techniques: Expressing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Single-cell RNA-seq reveals Arg1 is specifically expressed in mouse IS brain cell subsets (A and B) The cellular distribution of 8 cell clusters between sham and MCAO mice. (C)The bar plot shows the cell ratio between ischemic stroke mice and sham mice. (D) The cellular distribution of Arg1 in MCAO mice. (E) The cellular distribution of Arg1 between sham and MCAO mice.

Article Snippet: Primer Arg1 R: GGAGGTCTTGGTGATGTCCT , This paper , Sangon Biotech.

Techniques: Single Cell, RNA Sequencing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Single-cell RNA-seq of human PBMCs identifies ARG1 expression in IS patient immune subsets (A) Cell clusters were identified with UMAP projection of 90751 cells from controls and patients who had a stroke. (B) Bar plot of PBMC subset proportion between controls and IS patients. (C) Mean expression level of ARG1 in PBMC subtypes.

Article Snippet: Primer Arg1 R: GGAGGTCTTGGTGATGTCCT , This paper , Sangon Biotech.

Techniques: Single Cell, RNA Sequencing, Expressing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Relative mRNA expression levels of Arg1 , Vim , and Prpf31 : Comparison between MCAO rats and healthy control rats (A–C) Relative mRNA expression levels of Arg1 (A), Vim (B), and Prpf31 (C) in MCAO rats vs. healthy control rats. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 R: GGAGGTCTTGGTGATGTCCT , This paper , Sangon Biotech.

Techniques: Expressing, Comparison, Control

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: The VIM-PRPF31-ARG1 three-gene signature exhibits high diagnostic accuracy for IS (A and B) Receiver operating characteristic (ROC) curves demonstrating the discriminatory power of the three-gene signature in the GSE22255 -58294 training cohort. The area under the curve (AUC) values indicates high diagnostic accuracy. (C and D) ROC curves validating the diagnostic efficacy of the three-gene signature in the independent validation cohort GSE16561 -37587. (E, F, and G) Validation of differential expression patterns of VIM (E), PRPF31 (F) , and ARG1 (G) between normal controls and ischemic stroke samples in the GSE16561 -37587 dataset. ∗ p < 0.05, ∗∗ p < 0.01 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Diagnostic Assay, Biomarker Discovery, Quantitative Proteomics

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Key candidate biomarkers modulate immune cell infiltration during post-stroke recovery (A) Comparison of immune cell infiltration abundances between DAC subtypes. (B) Correlation network depicting significant interactions among immune cells by ssGSEA. (C) Correlation heatmap depicting associations of VIM , ARG1 , and PRPF31 with infiltrating immune infiltration cells. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Comparison

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Mendelian randomization identifies ARG1 as a causal protective factor for IS (A) Forest plot of MR model results. (B) Scatterplot of the five MR models. Each point represents an IV, with the line on each point indicating the 95% CI. The y axis shows the effect of SNPs on the outcome, and the x axis shows the effect of SNPs on exposure. (C) Forest plot of MR analysis results for each ARG1 -associated SNP; the red line represents the pooled effect of all SNPs, indicating that increased ARG1 expression is associated with reduced ischemic stroke risk. (D) MR sensitivity analysis for ARG1 after removing SNPs using the leave-one-out method. The red line represents the pooled results for all SNPs. (E) Funnel plot of 11 SNPs on MR analysis.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Expressing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Single-cell RNA-seq reveals Arg1 is specifically expressed in mouse IS brain cell subsets (A and B) The cellular distribution of 8 cell clusters between sham and MCAO mice. (C)The bar plot shows the cell ratio between ischemic stroke mice and sham mice. (D) The cellular distribution of Arg1 in MCAO mice. (E) The cellular distribution of Arg1 between sham and MCAO mice.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Single Cell, RNA Sequencing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Single-cell RNA-seq of human PBMCs identifies ARG1 expression in IS patient immune subsets (A) Cell clusters were identified with UMAP projection of 90751 cells from controls and patients who had a stroke. (B) Bar plot of PBMC subset proportion between controls and IS patients. (C) Mean expression level of ARG1 in PBMC subtypes.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Single Cell, RNA Sequencing, Expressing

Journal: iScience

Article Title: Integrated multi-omics identifies macrophage ARG1-mediated deacetylation with causal and diagnostic implications in ischemic stroke

doi: 10.1016/j.isci.2026.115269

Figure Lengend Snippet: Relative mRNA expression levels of Arg1 , Vim , and Prpf31 : Comparison between MCAO rats and healthy control rats (A–C) Relative mRNA expression levels of Arg1 (A), Vim (B), and Prpf31 (C) in MCAO rats vs. healthy control rats. ∗∗∗ p < 0.001, ∗∗ p < 0.01, ∗ p < 0.05 by Wilcoxon rank-sum test.

Article Snippet: Primer Arg1 F: TGCTGAAGGACACCTTTGCT , This paper , Sangon Biotech.

Techniques: Expressing, Comparison, Control